View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7989_high_10 (Length: 246)
Name: NF7989_high_10
Description: NF7989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7989_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 4 - 174
Target Start/End: Complemental strand, 6524479 - 6524307
Alignment:
| Q |
4 |
agatgcagataaaaatgagcaccacaacagcaacaactggtactactacggcgatgacgacagtagtagtgttgctatttcctgtataaaccaaattcaa |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6524479 |
agatgcagataaaaatgagcactacaacagcaacaactggtactactacggcgatgacgacagtagtagtgttgctatttcctgtataaaccaaattcaa |
6524380 |
T |
 |
| Q |
104 |
catgggacattacataacttcaaacaatacaatctgttcaattaaa--aaaattggtttttcatcaattagac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6524379 |
catgggacattacataacttcaaacaatacaatctgttcaattaaaaaaaaattggtttttcatcaattagac |
6524307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 226
Target Start/End: Complemental strand, 6524286 - 6524255
Alignment:
| Q |
195 |
ccacatggagaggaagtgttaatgctttgcct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6524286 |
ccacatggagaggaagtgttaatgctttgcct |
6524255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University