View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7989_high_12 (Length: 227)
Name: NF7989_high_12
Description: NF7989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7989_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 1458509 - 1458309
Alignment:
| Q |
1 |
tcgttagtcggtctataatcaagtaacaagtaacacctacaacgtacaaacaacannnnnnnnnna--ataaataaaacgtacaaataacataa---ctc |
95 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| || |||||||| |||||||||||||||||| ||||||| ||| |
|
|
| T |
1458509 |
tcgttagtcggtctataaccaagtaacaagtaacacctacaacatataaacaacattttttttttttgataaataaaacgtacaaacaacataaaatctc |
1458410 |
T |
|
| Q |
96 |
gaattcaaacccaattttaagatgtccaatctaaaaacaccggcattgcaagttgctcttagggacggggtctcacatgttaatatatatgcacattatg |
195 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
1458409 |
gaattcaaacccaattt-aagatgtccaatctaaaaacaccggcattgcaagttggcgttagggac----tctctcatattaatatatatgcacattatc |
1458315 |
T |
|
| Q |
196 |
actaga |
201 |
Q |
| |
|
|||||| |
|
|
| T |
1458314 |
actaga |
1458309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University