View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7989_low_9 (Length: 318)
Name: NF7989_low_9
Description: NF7989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7989_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 311
Target Start/End: Complemental strand, 44532272 - 44531979
Alignment:
| Q |
18 |
ctttttgtataacttaatgttcatggctacacaaaattgttcaaaatgtgtcatgttggtaacactactagtaacaattctctttgttcatccaacatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44532272 |
ctttttgtataacttaatgttcatggctacacaaaattgttcaaaatgtgtcatgttggtaacactactagtaacaattctctttgttcatccaacattc |
44532173 |
T |
 |
| Q |
118 |
tcaacatcaagagggtctctcaaccatcaccaaatctctcaaggcgggttccgaatcactcttcgccacgttgattccggcaaaaacttgactaaactcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44532172 |
tcaacatcaagagggtctctcaaccatcaccaaatctctcaaggcgggttccgaatcactcttcgccacgttgattccggcaaaaacttgactaaactcg |
44532073 |
T |
 |
| Q |
218 |
agcgcgttcaacatggcattaaccggggacatagccgacttcaaagactaaatgcaatggtgttagcatcatccacaactgaagattcatctca |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44532072 |
agcgcgttcaacatggcattaaccggggacatagccgacttcaaagactaaatgcaatggtgttagcatcatccacaactgaagattcatctca |
44531979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University