View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7990_high_6 (Length: 288)
Name: NF7990_high_6
Description: NF7990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7990_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 7331464 - 7331736
Alignment:
| Q |
18 |
actatttgaattaataacttggaagaccaactctat--tacaggagagaaaatgaggggtaaggaatggggagaaaaggaaaaaatttaacaagatgggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7331464 |
actatttgaattaataacttggaagaccaactctatattacaggagagaaaatgaggggtaaggaagggggagaaaaggaaaaaatttaacaagatgggg |
7331563 |
T |
 |
| Q |
116 |
agaacttacatttggattttttaatatggcaaggttgaggttcttcctttcatcactagagaaggcttcatccctttctgcatgtacagttcctgcaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7331564 |
agaacttacatttggattttttaatatggcaaggttgaggttcttcctttcatcactagagaaggcttcatccctttctgcatgtacagttcctgcaaat |
7331663 |
T |
 |
| Q |
216 |
gagatcaagtgatgaggtttgaaggaagtgacatctttatgacatagaaaatacttagatggtttctaaagtt |
288 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7331664 |
gagatcaagtgatgagatttgaaggaagtgacatctttatgacatagaaaatacttagatggtttctaaagtt |
7331736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University