View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_high_27 (Length: 276)
Name: NF7991_high_27
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 41622978 - 41622845
Alignment:
| Q |
14 |
ttctagcagtgacatatgaaagtcatgtgttaagaatcaagattaaggaatggcctacaatacaagacaggtcgttccccttgctccccttgtttggtgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41622978 |
ttctagcagtgacatatgaaagtcatgtgttaagaatcaagattaaggaatggcctacaatacaagacaggtcgttccctttgctccccttgtttggtgg |
41622879 |
T |
 |
| Q |
114 |
aattgcaaacaacctatacagtaagattctagct |
147 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |
|
|
| T |
41622878 |
aattgcaaacaacctatgcaataagattctagct |
41622845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 201 - 260
Target Start/End: Complemental strand, 41622791 - 41622732
Alignment:
| Q |
201 |
gttaactccttagaaatataatagtcttccattataaaaagaagaagcaattgaaaatcg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41622791 |
gttaactccttagaaatataatagtcttccattataaaaagaagaagcaattgaaaatcg |
41622732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University