View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_27 (Length: 394)
Name: NF7991_low_27
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 16700524 - 16700149
Alignment:
| Q |
1 |
taagaatttttgtttgcactaaaccatgtcaagattgaagttcaagctacagaagtttcccaacaagactctgtaacagttactcaagaaaacatggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700524 |
taagaatttttgtttgcactaaaccatgtcaagattgaagttcaagctacagaagtttcccaacaagactctgtaacagttactcaagaaaacatggcaa |
16700425 |
T |
|
| Q |
101 |
ccgtttcacatctaaccaaaaagccattgaagcaaaatgataaagcactaaaaccgtgctggaaccctcctgctccactcagtgagttttcaccattcat |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16700424 |
ccgtttcacatcttaccaaaaagccattgaagcaaaatgataaagcactaaaaccgtgctggaaccctcctgctccactcagtaagttttcaccattcat |
16700325 |
T |
|
| Q |
201 |
gattactcttgcttatgttgcttattgatcattgaagcagtatgaagtagacacaactaaggttttaacttttaagtcatagtcacagtcatggttttaa |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
16700324 |
gattactcttgcatatgttgcttattgatcattgaagcagtatgaagtagacacaactaaggttttaactttataatcatagtcacagtcatggttttaa |
16700225 |
T |
|
| Q |
301 |
atgcggttgaggtctcggttgcagttacgtgtcaaccgttattgtggtaaaatgtagatgacacgtttgaaattgt |
376 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16700224 |
atgcggttgtggtctcggttgcagttacgtgtcaaccgttattgtggtaaaatgtagatgacacatttgaaattgt |
16700149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University