View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_31 (Length: 329)
Name: NF7991_low_31
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 7583650 - 7583966
Alignment:
| Q |
1 |
tagcctctatagggtgcaatctcccctcaatatgctctttatgtcgtgctaaagaagaatcttcttttcaccttttctttgaatgttgatatgctgtcaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7583650 |
tagcttctatagggtgcaatctcccctcaatgtgctctttatgtcgtgctaaagaagaatcttcttttcaccttttctttgaatgttgatatgctatcaa |
7583749 |
T |
 |
| Q |
101 |
aatttggagatggtttgcttccattcttaattgtaacctccatttccaatctagagatgacatctggtccatatgtcagaaaccatcca-atcctcaagg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
7583750 |
aatttggagatggtttgcttccattcttaattgtaacctccatttccaatatagagatgacatctggtctatatgtcagaaaccatccagatcctcaagg |
7583849 |
T |
 |
| Q |
200 |
taagctagtgatcactgttactctaattaacatctttagtgttatttggtttgcaaggaaccagacaagattcaacaacataagttttccttggagaagc |
299 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7583850 |
taagctagtgatcactgctgctctaattaacatctttagtgttatttagtttgcaaggaaccagacaagattcaacaacataagttttccttggagaagc |
7583949 |
T |
 |
| Q |
300 |
tctatatctcaagtattat |
318 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
7583950 |
tc--tatctcaagtattat |
7583966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 7956575 - 7956531
Alignment:
| Q |
128 |
taattgtaacctccatttccaatctagagatgacatctggtccat |
172 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| || |||||||| |
|
|
| T |
7956575 |
taattgtaatctccaattccaatctagagatgatatttggtccat |
7956531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University