View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_32 (Length: 322)
Name: NF7991_low_32
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 134 - 319
Target Start/End: Original strand, 683524 - 683709
Alignment:
| Q |
134 |
accggaatccgaaaaatgcgaaagttcaaagtgttgttaccgaatggaactagtgtggaattgaaagttctgaagacagaaaatgcaatgcattttggtg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
683524 |
accggaatccgaaaaatgcgaaagttcaaagtgttgttaccgaatggaactagtgtggaattgaaagttctgaacacagaaaatgcaatgcattttggtg |
683623 |
T |
|
| Q |
234 |
aattcgttggattaattcgaactaggtatctcgaagttcagagaaagaatgaatccatgaggaagaaaagggaaatcaattggaat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683624 |
aattcgttggattaattcgaactaggtatctacaagttcagaggaagaatgaatccatgaggaagaaaagggaaatcaattggaat |
683709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 683423 - 683508
Alignment:
| Q |
18 |
gttcgtctttctgtttttacagagtttgaagcatggaaaggggaatgattaatcacaaccctaagaaacgaaaactggtgctaaac |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683423 |
gttcgtttttctgtttttacagagtttgaagcatggaaaggggaatgattaatcacaaccctaagaaacgaaaactggtgctaaac |
683508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 645796 - 645842
Alignment:
| Q |
157 |
gttcaaagtgttgttaccgaatggaactagtgtggaattgaaagttc |
203 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||| ||||||||| |
|
|
| T |
645796 |
gttcaaagtgttgttaccaaatggaacaattgtggaactgaaagttc |
645842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University