View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_33 (Length: 319)
Name: NF7991_low_33
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 70 - 298
Target Start/End: Original strand, 1008541 - 1008769
Alignment:
| Q |
70 |
gtttatgtgggttccctccctaactgcatagatagagttatctctgagattttgaatgttatgtgtgaattatgataatggcgttctattttaaacaaat |
169 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1008541 |
gtttaagtgggttccctccctaactgcatagatagagttatctctgagattttgaatgttatgtgtgaattatgataatgacgttctattttaaacaaat |
1008640 |
T |
|
| Q |
170 |
gcacaagtgcatgtttgtatccatgcaagtgtgtatgttaatttttaatgcatataatcttcaatataaaattgtgcaaaagattaatcatcagtttttt |
269 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1008641 |
gcacaagtgcatgtttgtatacatgcgagtgtgtatgttaatttttaatgcatataatcttcaatataaaattgtgcaaaagattaatcatcagtttttt |
1008740 |
T |
|
| Q |
270 |
aatacaacctaaaatataataaaataaga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1008741 |
aatacaacctaaaatataataaaataaga |
1008769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University