View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_34 (Length: 316)
Name: NF7991_low_34
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_34 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 96 - 298
Target Start/End: Complemental strand, 45070821 - 45070619
Alignment:
| Q |
96 |
taaatcacaattaataacacaattctccaaggccaatgatatgcctccatatttccatctacatgatgaggtgcatgggatatataccattggggtccct |
195 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070821 |
taaatcataattaataacacaattctccaaggccaatgatatgcctccatatttccatctacatgatgaggtgcatgggatatataccattggggtccct |
45070722 |
T |
 |
| Q |
196 |
tttactaacagtttatttgtgcttaaaaggaatgtattaactaactatataattgcttattgcaggaaaatggacatttctttcgaaatgtctagcactt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070721 |
tttactaacagtttatttgtgcttaaaaggaatgtattaactaactatataattgcttattgcaggaaaatggacatttctttcgaaatgtctagcactt |
45070622 |
T |
 |
| Q |
296 |
aca |
298 |
Q |
| |
|
||| |
|
|
| T |
45070621 |
aca |
45070619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 45071291 - 45071214
Alignment:
| Q |
18 |
tgcaacattgttaattggtgtggtggtaatattgcttgattgatacctaaggggatgttagttcgatacctactaggat |
96 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| || ||||||| ||||| ||||||||||||||| |
|
|
| T |
45071291 |
tgcaacattgttaactggtgtggtggtaatattgcttgattgata-cttgggggatgctagtttgatacctactaggat |
45071214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 19849380 - 19849424
Alignment:
| Q |
21 |
aacattgttaattggtgtggtggtaatattgcttgattgatacct |
65 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19849380 |
aacattgttaactggtgtggtggtaatattgcttgattgatacct |
19849424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 17756857 - 17756811
Alignment:
| Q |
18 |
tgcaacattgttaattggtgtggtggtaatattgcttgattgatacc |
64 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
17756857 |
tgcatcattgttaactggtgtggtggtaatattgctagattgatacc |
17756811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 44945196 - 44945154
Alignment:
| Q |
22 |
acattgttaattggtgtggtggtaatattgcttgattgatacc |
64 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
44945196 |
acattgttaactcgtgtggtggtaatattgcttgattgatacc |
44945154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 1075855 - 1075895
Alignment:
| Q |
18 |
tgcaacattgttaattggtgtggtggtaatattgcttgatt |
58 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
1075855 |
tgcaacattgttaactggtgtggtggtaattttgcatgatt |
1075895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 181774 - 181707
Alignment:
| Q |
18 |
tgcaacattgttaattggtgtggtggtaatattgcttgattgatacctaaggggatgttagttcgatacc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||| || ||| ||||||| ||||||| |||| |
|
|
| T |
181774 |
tgcaacattgttaattggtgtggtggtaattttgcatgattaatgcct--ggggatgctagttcggtacc |
181707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 87
Target Start/End: Original strand, 34884384 - 34884446
Alignment:
| Q |
24 |
attgttaattggtgtggtggtaatattgcttgattgatacctaaggggatgttagttcgatacc |
87 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| |||||| || ||||||| |||||||||||| |
|
|
| T |
34884384 |
attgttaactggtgtggtggtaaaattgcttgtttgata-cttgggggatgctagttcgatacc |
34884446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 4428756 - 4428802
Alignment:
| Q |
24 |
attgttaattggtgtggtggtaatattgcttgattgatacctaaggg |
70 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
4428756 |
attgttaactggtgtggtggtaaaattgcttgtttgatacctgaggg |
4428802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 25644864 - 25644797
Alignment:
| Q |
18 |
tgcaacattgttaattggtgtggtggtaatattgcttgattgatacctaaggggatgttagttcgatacc |
87 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| || | | ||||||| |||||||||||| |
|
|
| T |
25644864 |
tgcaacattgttaagtggtgtggtggtaattttgcatgattaatgc--atggggatgctagttcgatacc |
25644797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University