View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_38 (Length: 286)
Name: NF7991_low_38
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 64 - 267
Target Start/End: Complemental strand, 12266391 - 12266190
Alignment:
| Q |
64 |
ttaatttcttatacgaagtttcacataacataaaaattaattatttaatattgttgcaagtcgtcaacttgaatcaagcaatcaatgtcagcatatgcat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12266391 |
ttaatttcttatacgaagtttcacataacataaaaattaattatttaatattgttgcaagtcgtcaacatgaatcaagcaatcaatgtcagcatatgcat |
12266292 |
T |
 |
| Q |
164 |
tccgcgagcacctatnnnnnnnnntacacaagtaaatatctctatacataaaatgaacttgagtcattcttgaactaaaatataagaaaattgaaccaaa |
263 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12266291 |
tccgcgagcacctataaaaaaaaatacacaagtaaata--tctatacataaaattaacttgagtcattcttgaactaaaatataagaaaattgaaccaaa |
12266194 |
T |
 |
| Q |
264 |
taga |
267 |
Q |
| |
|
|||| |
|
|
| T |
12266193 |
taga |
12266190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 70
Target Start/End: Complemental strand, 12266436 - 12266404
Alignment:
| Q |
38 |
tagcaaatggacattttaaattaaaattaattt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12266436 |
tagcaaatggacattttaaattaaaattaattt |
12266404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University