View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_41 (Length: 277)
Name: NF7991_low_41
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 18237396 - 18237147
Alignment:
| Q |
1 |
gacatggtgaagagtgaagttgggcgttgtcatggtgtagaactgtgctcgttgtcattgagggaagacgatgataagtggttgtggaagccagaagagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18237396 |
gacatggtgaagagtgaagttgggcgttgtcatggtgtagaagtttgctcgttgtcattgagggaagacgatgataagtggttgtggaagccggaagagg |
18237297 |
T |
|
| Q |
101 |
aaggtgtgggttactgaggggttgcttgttctggataatgattttagtgttgcggttgaattccaactcaaatcaactttattgctttgtttaggtatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18237296 |
aaggtgtgggttactgaggggttgcttgttttggataatgattttagtactgcggttgaattccaactcaaatcaaccttattgctttgtttaggtatct |
18237197 |
T |
|
| Q |
201 |
ctttgtaaactcctttagaccgtgtcctttgtacgagtaccgtagaaagt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
18237196 |
atttgtaaactcctttagaccgtgtcctttgtatgagtactgtagaaagt |
18237147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University