View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_48 (Length: 257)
Name: NF7991_low_48
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_48 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 28764838 - 28764648
Alignment:
| Q |
11 |
gtcgaagaatatcaccgttaatcctccatgatgacctgttcactcaggtcttattattgcttcctgttaaatctcttatgcaactaaagtgcgtttgcaa |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764838 |
gtcgaagattatcaccgttaatcctccatgatgacctgttcacccaggtcttattattgcttcctgttaaatctcttatgcaactaaagtgcgtttgcaa |
28764739 |
T |
 |
| Q |
111 |
gtcttggaacaccctcatctccagtcccaccttcgttgaattacaccttcagcaatcaca---acgaaaaaggcaactattactaacatat |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
28764738 |
gtcttggaacaccctcatctccggtcccaccttcgttgaattacaccttcagcaatcacaacgacgaaaaaggcaactactactaacatat |
28764648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 70 - 132
Target Start/End: Complemental strand, 5437741 - 5437679
Alignment:
| Q |
70 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctcc |
132 |
Q |
| |
|
||||||||||||| |||||||||| | ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5437741 |
cttcctgttaaatatcttatgcaaatgaagtgtgtttgcaagtcatggaacaccctcatctcc |
5437679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 131
Target Start/End: Original strand, 553743 - 553804
Alignment:
| Q |
70 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctc |
131 |
Q |
| |
|
||||||||| ||| |||||||| | | ||||| |||||||| || ||||||||||||||||| |
|
|
| T |
553743 |
cttcctgttgaatatcttatgcgaatgaagtgtgtttgcaaatcatggaacaccctcatctc |
553804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 126
Target Start/End: Original strand, 18325428 - 18325484
Alignment:
| Q |
70 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctc |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||| || || |||||||||||| |
|
|
| T |
18325428 |
cttcctgtgaaatctcttatgcaactaaagtgctgttgtaaatcatggaacaccctc |
18325484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 132
Target Start/End: Original strand, 161095 - 161148
Alignment:
| Q |
79 |
aaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctcc |
132 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
161095 |
aaatctcttatgcagatgaagtgtgtttgcaagtcttggaaaaccctaatctcc |
161148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University