View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_52 (Length: 243)
Name: NF7991_low_52
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 119 - 188
Target Start/End: Original strand, 30918107 - 30918176
Alignment:
| Q |
119 |
cctaagatattttcccaatccatagtttatggcaatcaaacttctttaaaagttgtctgatcaaatattt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30918107 |
cctaagatattttcccaatccatagtttatggcaatcaaacttctttaaacgttgtctgatcaaatattt |
30918176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 30918050 - 30918107
Alignment:
| Q |
16 |
ttgctagtgatttttgacacaacattagctcagaactctattcatgaatataacatatatc |
76 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
30918050 |
ttgctagtgattt---acacaacattagctcacaactctatccatgaatataacatatatc |
30918107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University