View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7991_low_53 (Length: 241)

Name: NF7991_low_53
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7991_low_53
NF7991_low_53
[»] chr3 (1 HSPs)
chr3 (5-225)||(39280234-39280445)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 39280234 - 39280445
Alignment:
5 aagaatctcttaaactatttcaattgtattgtaaattccccgaagttcagccatgagaaccgaacacgatccggacattgcactcttttattagataacg 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39280234 aagaatctcttaaactatttcaattgtattgtaaattccccgaagttcagccatgagaaccgaacacgatccggacattgcactcttttattagataacg 39280333  T
105 atgtaaacgatgtaaaacccagcaaacgaactattcctatttctttcaagtttcaaccaaaacaatacattacttcaatttctaacatcacaatgctata 204  Q
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
39280334 ---------atgtaaaacccagcaaacgaactattcctatttctttcaagtttcaaccaaaacaatccattacttcaattactaacatcacaatgctata 39280424  T
205 tacacttgcagtgcaagttaa 225  Q
    |||||||||||||||||||||    
39280425 tacacttgcagtgcaagttaa 39280445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University