View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7991_low_56 (Length: 221)
Name: NF7991_low_56
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7991_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 40514214 - 40514009
Alignment:
| Q |
1 |
tatatatgaagcttttgctcatttgcattttcttgcttcaactat-gtgttctaaaatgcttttacacgttcttgttcgaatattggtatttgatcagaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40514214 |
tatatatgaagcttttgctcatttgcattttcttgcttcaactatagtgttctaaaatgcttttacacgttcttgttcgaatattggtatttgaacagaa |
40514115 |
T |
|
| Q |
100 |
taagaatagagtgctaattgccttagcgcgttaccatcatcgatatttgtggccacaatacattaaccaattttttcttgttatctagattcatagtttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514114 |
taagaatagagtgctaattgccttagtgcgttaccatcatcgatatttgtggccacaatacattaaccaattttttcttgttatctagattcatagtttt |
40514015 |
T |
|
| Q |
200 |
ggtcga |
205 |
Q |
| |
|
|||||| |
|
|
| T |
40514014 |
ggtcga |
40514009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University