View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7991_low_6 (Length: 568)

Name: NF7991_low_6
Description: NF7991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7991_low_6
NF7991_low_6
[»] chr7 (2 HSPs)
chr7 (188-302)||(42028064-42028178)
chr7 (371-403)||(42028038-42028070)
[»] chr1 (1 HSPs)
chr1 (78-334)||(26629676-26629932)
[»] chr5 (3 HSPs)
chr5 (117-403)||(29237297-29237583)
chr5 (214-403)||(29233644-29233833)
chr5 (330-391)||(42280343-42280404)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 4e-58; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 188 - 302
Target Start/End: Complemental strand, 42028178 - 42028064
Alignment:
188 cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42028178 cgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctct 42028079  T
288 tggcatatgacagca 302  Q
    |||||||||||||||    
42028078 tggcatatgacagca 42028064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 371 - 403
Target Start/End: Complemental strand, 42028070 - 42028038
Alignment:
371 gacagcacgccacttggcaaatcgggcaccagc 403  Q
    |||||||||||||||||||||||||||||||||    
42028070 gacagcacgccacttggcaaatcgggcaccagc 42028038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 73; Significance: 4e-33; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 78 - 334
Target Start/End: Original strand, 26629676 - 26629932
Alignment:
78 gctataacttcaggggcaactttttgagaatctaaaccgggggttaccatgttaggcttcaaaagagttccttcgagcagaacatgatgatcacttaaag 177  Q
    |||||||| ||||| ||||||||  |||||||| | || || || ||||| ||||||||||||||||| ||||| || ||||||||||| ||||||| ||    
26629676 gctataacctcaggagcaactttaggagaatctgatcctggtgtaaccatattaggcttcaaaagagtaccttcaagaagaacatgatggtcacttagag 26629775  T
178 ctttgtagcacgcagccagaacacgttcagtcacctcagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactag 277  Q
    | ||||| || || || ||||| ||||| || || ||||| |||||    ||||| || | |||||||||||| || || |||||||| || ||||| |     
26629776 ccttgtaacatgctgcaagaacgcgttctgttacatcagcgcactttgcaatgtcgtggggtccatccactagaatctcaggctccacaattggaaccaa 26629875  T
278 gccattctcttggcatatgacagcatagcgagctagaccataggcgttctcgtggat 334  Q
     ||||||||||| |||||||| || || ||||||| |||||||||||| ||||||||    
26629876 accattctcttgacatatgacggcgtaacgagctaaaccataggcgttttcgtggat 26629932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 51; Significance: 6e-20; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 117 - 403
Target Start/End: Original strand, 29237297 - 29237583
Alignment:
117 ggggttaccatgttaggcttcaaaagagttccttcgagcagaacatgatgatcacttaaagctttgtagcacgcagccagaacacgttcagtcacctcag 216  Q
    ||||| ||||||||||||||||| ||||| ||||| || || ||||| || ||| | || || |||||||| || || || ||    || || ||  |||    
29237297 ggggtaaccatgttaggcttcaagagagtgccttcaaggaggacatggtggtcattcaaggccttgtagcatgctgcaaggaccttctcggtaacagcag 29237396  T
217 cacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctcttggcatatgacagcatagcgagctagacc 316  Q
    ||||||| |  |||||||||| |||||| || ||||| || ||||| || || || || || |||||||||||||||||||| ||||| || || | |||    
29237397 cacacttttgaatgtcatgaggtccatcaacaaggatctcaggctcaacaattggtacaagtccattctcttggcatatgactgcatatcgggccaaacc 29237496  T
317 ataggcgttctcgtggatagccagctcagatggctcgttgggaccaatcttgaggacagcacgccacttggcaaatcgggcaccagc 403  Q
    |||||| |||||||||||||   ||||||||||||| ||||| || || || || || |||||||| || || || || ||||||||    
29237497 ataggcattctcgtggatagagtgctcagatggctcattggggccgattttaagcactgcacgccatttagcgaaacgtgcaccagc 29237583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 214 - 403
Target Start/End: Original strand, 29233644 - 29233833
Alignment:
214 cagcacacttgttgatgtcatgagatccatccactaggatttcgggctccactataggaactaggccattctcttggcatatgacagcatagcgagctag 313  Q
    |||||||||| |  |||||||||| |||||| || ||||| || ||||| || || || || || |||||||||||||||||||| ||||| || || |     
29233644 cagcacacttttgaatgtcatgaggtccatcaacaaggatctcaggctcaacaattggtacaagtccattctcttggcatatgactgcatatcgggccaa 29233743  T
314 accataggcgttctcgtggatagccagctcagatggctcgttgggaccaatcttgaggacagcacgccacttggcaaatcgggcaccagc 403  Q
    ||||||||| |||||||||||||   ||||||||||||| ||||| || || || || || |||||||| || || || || ||||||||    
29233744 accataggcattctcgtggatagagtgctcagatggctcattggggccgattttaagcactgcacgccatttagcgaaacgtgcaccagc 29233833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 330 - 391
Target Start/End: Complemental strand, 42280404 - 42280343
Alignment:
330 tggatagccagctcagatggctcgttgggaccaatcttgaggacagcacgccacttggcaaa 391  Q
    ||||||| || |||||| ||||| |||||||||||||||||||| |||||||||||||||||    
42280404 tggatagacaactcagagggctcattgggaccaatcttgaggaccgcacgccacttggcaaa 42280343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University