View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7992_low_4 (Length: 291)
Name: NF7992_low_4
Description: NF7992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7992_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 37588041 - 37588315
Alignment:
| Q |
1 |
ttgaacgattttccttctcttcggccaaatttggaatactagtattttttgactc-actcttttgctagaaacctaacttcattgtgttttttatccttt |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588041 |
ttgaacgattttccttcttttcggccaaatctggaatactagtattttttgactctaatcttttgctagaaacctaacttcattgtgttttttatccttt |
37588140 |
T |
 |
| Q |
100 |
gagatttgcctttgatgatagaaacaacttctatattgcctttgatttactcttacccttcttttattttatgctgagttcaactttttacaggaggaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| |||| |
|
|
| T |
37588141 |
gagatttgcctttgatgatagaaacaacttctatattgcctttgatttactcttacccttcttttattttatggtgagtttaactttttaccggaagaaa |
37588240 |
T |
 |
| Q |
200 |
tacactgttattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588241 |
tacactgttattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttc |
37588315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 208 - 264
Target Start/End: Original strand, 33722010 - 33722065
Alignment:
| Q |
208 |
tattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacat |
264 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33722010 |
tattgatagtttctgctatttttctttta-tgtcagatttctatctattgtgaacat |
33722065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 37583206 - 37583254
Alignment:
| Q |
1 |
ttgaacgattttccttctcttcggccaaatttggaatactagtattttt |
49 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
37583206 |
ttgaaagattttccttcttgtctgccaaatttggaatactagtattttt |
37583254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University