View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7993_low_5 (Length: 233)
Name: NF7993_low_5
Description: NF7993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7993_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 50930213 - 50930012
Alignment:
| Q |
16 |
aatatctaggacaagttaaaatacataataatctttatttgactctttctttcagagtatcaaattttgaaagaacattcattctgtaacgtattaagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50930213 |
aatatctaggacaagttaaaatacataataatctttatttgactctttctttcagagtatcaaattttgaaagaacattcattctgtaacgtattaagct |
50930114 |
T |
|
| Q |
116 |
agttataacttctgtcnnnnnnntaaataaagaagctagtggtaactgatgatatttgactttgttcatattgtcacgatatccaaatttggccaagtta |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50930113 |
agttataacttctgtcaaaaaaataaataaagaagctagtggtaactgatgatatttgactttgttcatattgtcacgatatccaaatttggccaagtta |
50930014 |
T |
|
| Q |
216 |
ct |
217 |
Q |
| |
|
|| |
|
|
| T |
50930013 |
ct |
50930012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University