View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_high_21 (Length: 206)
Name: NF7994_high_21
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 35992547 - 35992375
Alignment:
| Q |
15 |
atgaaatcataaagaaaatgaaattatgagatatgtttgtccttttctttttagacaaagattatgttcatgatggagatggtttaactgtgaaaataat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35992547 |
atgaaatcataaagaaaatgaaattatgagatatgtttgtctttttctttttagacaaagattatgttcatgatggagatggtttaactgtgaaaataat |
35992448 |
T |
 |
| Q |
115 |
tatgatgattattgttaattaggggaatggtgggatgcaaaccctattgatgttgtgagacaagccacacaaa |
187 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35992447 |
tatgatgattattattaattaggggaatggtgggatgcaaaccctattgatgttgtgagacaagccacacaaa |
35992375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University