View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_low_14 (Length: 299)
Name: NF7994_low_14
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 52756337 - 52756210
Alignment:
| Q |
18 |
ctgttgtctgctaaagtctcctaatgtttgtctcgatttatcttc-aatgttatttacttttataccatgcacaatgaaataaccaattcctgggcagta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||| |||| |
|
|
| T |
52756337 |
ctgttgtctgctaaagtctcctaatgtttgtctcgatttatcttccaatgttatttacttttataccatgcacaatgaaacaaccaatacctgggtagta |
52756238 |
T |
 |
| Q |
117 |
ctatctatgatcaattattgctcatgag |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52756237 |
ctatctatgatcaattattgctcatgag |
52756210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 244 - 286
Target Start/End: Complemental strand, 52756114 - 52756072
Alignment:
| Q |
244 |
cgtagtttctcggttgaaattaaccatcaatccccaacaccaa |
286 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
52756114 |
cgtagtttctctgttgaaattaatcatcaatccccaacaccaa |
52756072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University