View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_low_15 (Length: 264)
Name: NF7994_low_15
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 35835694 - 35835930
Alignment:
| Q |
18 |
gatatgtcaaatcattgtacaaaatttggcaaggtttaactgtaaatagaaacccttaagccttttgagatgaaggtaactaatcaactaagcaaaactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835694 |
gatatgtcaaatcattgtacaaaatttggcaaggtttaactgtaaatagaaacccttaagccttttgagatgaaggtaactaatcaactaagcaaaactt |
35835793 |
T |
 |
| Q |
118 |
gtatgttacaaaggaaagcaaaaataaatgcagcagttggtacaaagataacatcagggtctctcat-tttctatgaatccttccttacaacccttccct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35835794 |
gtatgttacaaaggaaagcaaaaataaatgcagcagttggtacaaagataacatcagggtctctcatccttctatgaatccttccttacaacccttccct |
35835893 |
T |
 |
| Q |
217 |
caacaaatacataaccaagctcagtatcttcttctca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835894 |
caacaaatacataaccaagctcagtatcttcttctca |
35835930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University