View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_low_20 (Length: 239)
Name: NF7994_low_20
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 133 - 224
Target Start/End: Complemental strand, 47212012 - 47211921
Alignment:
| Q |
133 |
agattagtacaaaccattagggcaatggaaatgacaagttgaggtcggttattgcgcttgaggagatttctgaatggatgtttcacctcttt |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212012 |
agattagtacaaaccattagagcaatggaaatgacaagttgaggtcggttattgcgcttgaggagatttctgaatggatgtttcacctcttt |
47211921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 40 - 133
Target Start/End: Complemental strand, 47212140 - 47212051
Alignment:
| Q |
40 |
cgctattccaattagggcggttttaacttttaaacgtatttgactacaattctctatatataaaacaagaattgttaagcgattgcaaccatga |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212140 |
cgctattccaattagggcggttttaacttttaaacgtatttgactacaattctc----tataaaacaagaattgttaagcgattgcaaccatga |
47212051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University