View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_low_22 (Length: 209)
Name: NF7994_low_22
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 1879762 - 1879586
Alignment:
| Q |
16 |
aagaaggtgtttcacaacaatgttatgcatagtaacattttgtatgatctccacaacagcaaaagctagaagcaccaaaagtattagcattgagatgtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1879762 |
aagaaggtgtttcacaacaatgttatgcatagtaacattttgtatgatctccacaacagcaaaagctagaagcaccaaaagtattagcattgagatgtaa |
1879663 |
T |
 |
| Q |
116 |
acgactctaagaaaccttttttggttagtgacatggtgttcttgtggaagagtaattattgagggagcatggttttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1879662 |
acgactctaagaaaccttttttggttagtgacatggtgttcttgtggaagagtaattattgagggagcatggttttg |
1879586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University