View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7994_low_9 (Length: 360)
Name: NF7994_low_9
Description: NF7994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7994_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 351
Target Start/End: Complemental strand, 21483137 - 21482804
Alignment:
| Q |
18 |
gtattggcagactatgaccggtgggacagcagcttccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgaccgccccaccatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483137 |
gtattggcagactatgaccggtgggacagcagcctccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgaccgccccaccatg |
21483038 |
T |
|
| Q |
118 |
cagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttaagctgtatattattgttagatcatatgttttggttgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
21483037 |
cagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttcagctttatattattgttagattatatgttttggttgttt |
21482938 |
T |
|
| Q |
218 |
atatgatctacgatgtgtgattattagaaatgcatgttaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaacaaccgtaatt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482937 |
atatgatctacgatgtgtgattattagaaatgcatgtaaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaacaaccgtaatt |
21482838 |
T |
|
| Q |
318 |
gtggctgcaatataatggctttaaaggtctctgc |
351 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
21482837 |
gtggctgcaatataatggttttaaaggtctctgc |
21482804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 332
Target Start/End: Complemental strand, 21490796 - 21490752
Alignment:
| Q |
288 |
agttttaaattatggtcaacaaccgtaattgtggctgcaatataa |
332 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |||||| |
|
|
| T |
21490796 |
agttttaaattttggtctgcaaccgtaattgtggctgcgatataa |
21490752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University