View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_high_18 (Length: 271)
Name: NF7996_high_18
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 14600947 - 14600686
Alignment:
| Q |
1 |
tcagttgctttttattctctctgcaacaactcaacacaagataatggaatcaatctgaatttctctagtacaaaccattcacagatctcaacgatctcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14600947 |
tcagttgctttttattctctctgcaacaacccaacacaagataatggaatcaatctgaatttctctagtacaaaccattcacagatctcaacgatctcac |
14600848 |
T |
 |
| Q |
101 |
tcacattttcacctttcaatactaaagtttttacctttatagtatgctttttcagttggattcaaattctccaacttggttgacatacgaaagctatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14600847 |
tcacattttcacctttcaatactaaagtttttacctttatagtatgctttttcagttggattcaaattctccaacttggttgacatacgaaagctatttt |
14600748 |
T |
 |
| Q |
201 |
ggcatctgggttctgtttgttcatgctcattgaattgtgtcttaatggaaagttgatatttt |
262 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14600747 |
ggcatctgggttctgtttgtttatgctcattgaattgtgtcttaatggaaagttgatatttt |
14600686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University