View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_high_24 (Length: 232)
Name: NF7996_high_24
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 7009071 - 7009262
Alignment:
| Q |
19 |
attctcctcgtcatttgtggtttcaactgtgcttttacttccttcactgacagttacacaggaagcgatggccagagacactatggtattgttaccacga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7009071 |
attctcctcgtcatttgtggtttcaactgtgcttttacttccttcactgacagttacaccggaagcgatggccagagacactatggtattgttaccatga |
7009170 |
T |
 |
| Q |
119 |
atggtctctggccatctccagcatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtg |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009171 |
atggtctctggccatctccgggatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtg |
7009262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University