View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7996_high_24 (Length: 232)

Name: NF7996_high_24
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7996_high_24
NF7996_high_24
[»] chr2 (1 HSPs)
chr2 (19-210)||(7009071-7009262)


Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 7009071 - 7009262
Alignment:
19 attctcctcgtcatttgtggtttcaactgtgcttttacttccttcactgacagttacacaggaagcgatggccagagacactatggtattgttaccacga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||    
7009071 attctcctcgtcatttgtggtttcaactgtgcttttacttccttcactgacagttacaccggaagcgatggccagagacactatggtattgttaccatga 7009170  T
119 atggtctctggccatctccagcatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtg 210  Q
    ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7009171 atggtctctggccatctccgggatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtg 7009262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University