View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_16 (Length: 360)
Name: NF7996_low_16
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 28 - 279
Target Start/End: Complemental strand, 30723841 - 30723592
Alignment:
| Q |
28 |
tttcgtgttataagacttagcggtgttgtttagattatgagcattctcccattcttttataagcttcttctctgtatctctcaaatcccaataatcaata |
127 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723841 |
tttcgtgatataagacttagcagtgttttttagattatgag-attctccc-ttcttttataagcttcttctctgtatctctcaaatcccaataatcaata |
30723744 |
T |
|
| Q |
128 |
gtacgatgtgaggaaaacttttcttcaacaaagaaaaatgatatgagacctgacagtaactgatagttattagtcacttcagctacttgcctacttatat |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723743 |
gtacgatgtgagtaaaacttttcttcaataaagaaaaatgatatgagacctgacagtaagtgatagttattagtcacttcagctacttgcctacttatat |
30723644 |
T |
|
| Q |
228 |
tccaaggagccaacagttctctttctcacatgcacaaaattatgaataaata |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723643 |
tccaaggagccaacagttctctttctcacatgcacaaaattatgaataaata |
30723592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University