View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_18 (Length: 339)
Name: NF7996_low_18
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 9086629 - 9086943
Alignment:
| Q |
1 |
atttgtttagaagtgtaccattctttggtgataagttgtattcttacccccctcttggaatcaactcaatgtggatttttctttgcaatattattgatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086629 |
atttgtttagaagtgtaccattctttggtgataagctgtattcttacccccctcttggaatcaactcaatgtggatttttctttgcaatattattgatcc |
9086728 |
T |
|
| Q |
101 |
ttaaaatttaaagcttgttgtaacaaatcatgagctatactatgtgcattaaccgctcattttcgccaaatttatcaatgagctcctaaacacaatcaac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086729 |
ttaaaatgtaaagcttgttgtaacaaatcatgagctatactatgtgcattaaccgctcattttcgccaaatttatcaatgagctcctaaacacaatcaac |
9086828 |
T |
|
| Q |
201 |
ctctctgatagccttaatatctccnnnnnnnnnngtccttattccaaattttcaaagccacatttcggagctgtaacttcttatggagcacaagcattag |
300 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
9086829 |
ctctctgatagccttaatatcttc---aaaaaaagtccttaatccaaattttcaaagccacatttcggagctgtaacttcttatgaagcacaagcataag |
9086925 |
T |
|
| Q |
301 |
attgcattagtcatatac |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9086926 |
attgcattagtcatatac |
9086943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University