View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_21 (Length: 313)
Name: NF7996_low_21
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 27344564 - 27344357
Alignment:
| Q |
8 |
attagagagaatttcttccagattaaaaannnnnnnnnnggttacattccagattaaaaactttgataacatagagagatgcgccaaatttagccaccga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27344564 |
attagagagaatttcttccagattaaaaactttttttttggttacattccagattaaaaactttgataacatagagagatgcgccaaatttagccaccga |
27344465 |
T |
 |
| Q |
108 |
tttcgaatttctatttaatgtataagataagatattgtgttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgtttgcaatttgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27344464 |
tttcgaatttctatttaatgtataagataagatattgtgttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgttttcaatttgt |
27344365 |
T |
 |
| Q |
208 |
ttaatgac |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
27344364 |
ttaatgac |
27344357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University