View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_34 (Length: 247)
Name: NF7996_low_34
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 24505678 - 24505907
Alignment:
| Q |
1 |
gttgatagcttgagttttccaaatttggatagccttgtaaccacttttaacccgtatagtttccgttcggttcatgcatccacatgagggtatcctcctt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505678 |
gttgatagcttgagttttccaaacttggatagccttgtaaccacttttaacc-gtatagtttccgttcggttcatgcatccacatgagggtatcctcctt |
24505776 |
T |
 |
| Q |
101 |
attagtgtttatcaggggaattttctcaatggtggccctgaccaggggaataaataaagaacctaaaatctccttgttccaactagaagtttcgctgtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505777 |
attagtgtttatcaggggaattttctcaatggtggccctgtccaggggaataaataaagaacctaaaatctccttgttccaactagaagtttcgctgtga |
24505876 |
T |
 |
| Q |
201 |
attaagtctttaacaaatctgtagttagaat |
231 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
24505877 |
attaagtctttaacaaatctgcagttagaat |
24505907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University