View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_42 (Length: 207)
Name: NF7996_low_42
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 49673614 - 49673436
Alignment:
| Q |
17 |
aaatatgtatcgtaatcgaagatttttatctactcaatacgggttcgaaacatggcatcaattgtgtgatgatatccgacagcgtagcaaagagttcctt |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673614 |
aaatatgtatcgtaattgaagatttttatctactcaatacgggttcgaaacatggcatcaattgtgtgatgatatccgacagcgtagcaaagagttcctt |
49673515 |
T |
|
| Q |
117 |
gagaaatatggtacaaaatcacgttcagatatgatatgctggcccttaaatgtaataataaaactaaactgcgtgtgtg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673514 |
gagaaatatggtacaaaatcacgttcagatatgatatgctggcccttaaatgtaataataaaactaaactgcgtgtgtg |
49673436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University