View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7996_low_43 (Length: 207)
Name: NF7996_low_43
Description: NF7996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7996_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 9161623 - 9161791
Alignment:
| Q |
18 |
atgaacacacatagaattagttgcattatcatacttcattttccatcacaatagttgcatgcagatttcttttctatgtctattgtgaaatgattccatg |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9161623 |
atgaacacacatagaactagttgcattatcatacttcattttccatcacaatagttgcatgcagatttcttttctatgtctattgtgaaatgattccatg |
9161722 |
T |
 |
| Q |
118 |
actctgagcagttcttatgcttcttaaagcgaggaggtttgcactattagagactgtgggtataggggt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9161723 |
actctgagcagttcttatgcttcttaaagcgaggaggtttgcactattagagactgtgggtataggggt |
9161791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University