View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7997_high_1 (Length: 283)
Name: NF7997_high_1
Description: NF7997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7997_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 56277849 - 56278104
Alignment:
| Q |
18 |
caaagcttggaagaaatccaatgagatatgcgactgtaattatgttttgattaaaaacaaagggttatacataggaggtgtcttgcattggcttacagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56277849 |
caaagcttggaagaaatccaatgagacatgcgactgtaattatggtttgattaaaaacaaagggttatacataggaggtgtcttgcattggcttacagaa |
56277948 |
T |
 |
| Q |
118 |
ggtgatcaaatcatcacctttaatcttgaaaaggaactgtctttgatgatttcagtacctgttcctgcatgtgagtttaggaccgtccctcaagcttgca |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56277949 |
ggtgatcaaatcatcacctttaatgttgaaaaggaactgtctttgatgatttcagtacctgttccggcatgtgagtttaggaccgtccctcaagcttgca |
56278048 |
T |
 |
| Q |
218 |
ttggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278049 |
ttggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcat |
56278104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University