View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7997_low_11 (Length: 233)
Name: NF7997_low_11
Description: NF7997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7997_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 10930713 - 10930521
Alignment:
| Q |
1 |
aatttctctcaaaaatattaaaaggaccaaattacatccactttctatgaga--taaaccccggatgtacaaaaacatgtagagatcaaaatccttacaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930713 |
aatttctctcaaaaatattaaaaggaccaaattacatccactttctatgagagataaaccccggatgtacaaaaacatgtagagatcaaaatccttacaa |
10930614 |
T |
 |
| Q |
99 |
tacaaaaaatgcagctaaaatacttcgagatgaagtattaccccaaacaggaaacacctatatacatcctactactatcgacactgatgatgt |
191 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930613 |
tacaaaaaaagcagctaaaatacttcgagatgaagtattaccccaaacaggaaacacctatatacatcctactactatcgacactgatgatgt |
10930521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University