View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7997_low_4 (Length: 406)
Name: NF7997_low_4
Description: NF7997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7997_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 19 - 270
Target Start/End: Original strand, 45468113 - 45468364
Alignment:
| Q |
19 |
taaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggatttgagttggaacatgaaagaatttctgctgtttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468113 |
taaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggatttgagttggaacatgaaagaatttctgctgtttct |
45468212 |
T |
 |
| Q |
119 |
ttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccggtcccggtaggtgtcaattaggtcgatttattc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45468213 |
ttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccggtcccggtaggtctcaattaggtcgatttattc |
45468312 |
T |
 |
| Q |
219 |
gagtttatttactgtcataaacaatataaaattgtatgaaaacaatttatga |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468313 |
gagtttatttactgtcataaacaatataaaattgtatgaaaacaatttatga |
45468364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 314 - 394
Target Start/End: Original strand, 45468364 - 45468444
Alignment:
| Q |
314 |
atatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgttttatattatgtaggtgatgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468364 |
atatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgttttatattatgtaggtgatgat |
45468444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 394
Target Start/End: Complemental strand, 39220717 - 39220615
Alignment:
| Q |
295 |
ttttcaacttatttttgtaatatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgt---tttatattatgtaggtgat |
391 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| | ||| |||| || |||||||| | ||||| |||||||| | ||| ||||||||||||||| |
|
|
| T |
39220717 |
ttttcagcttatttttataatatatgataagcgcttaagttacaagcgttggattaatttagaatttgacatttttttttatttttattatgtaggtgat |
39220618 |
T |
 |
| Q |
392 |
gat |
394 |
Q |
| |
|
||| |
|
|
| T |
39220617 |
gat |
39220615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University