View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7997_low_7 (Length: 331)
Name: NF7997_low_7
Description: NF7997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7997_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 321
Target Start/End: Complemental strand, 51913793 - 51913489
Alignment:
| Q |
17 |
actcacttgaccatgtgaaactcattgtcaagcgtcctaatgttaattgttctacctatttgtctggccctggtgatcttaattacccatcattttctgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51913793 |
actcacttgaccatgtgaaactcattgtcaagcgtcctaatgttaattgttctacctatttgtctggccctggtgatcttaattacccatcattttctgt |
51913694 |
T |
 |
| Q |
117 |
tgtttttggtaacaatagtggtgttgttcaatacaagcggacacttactaacgttggggaggcaaaatctgtttatgatgtagctgttagtgggccatcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51913693 |
tgtttttggtaacaatagtggtgttgttcaatacaagcggacacttactaacgttggggaggcagaatctgtttatgatgtagctgttagtgggccatct |
51913594 |
T |
 |
| Q |
217 |
acggtggggataattgtgaatcctaccaagctggtttttgagcaagttggtgaaaggcaaacatatatggttaagtttatatcaaacaaggatattgttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51913593 |
acggtggggataattgtgaatcctaccaagctggtttttgagcaagttggtgaaaggcaaacatatatggttaagtttatatcaaacaaggatattgttg |
51913494 |
T |
 |
| Q |
317 |
atgat |
321 |
Q |
| |
|
||||| |
|
|
| T |
51913493 |
atgat |
51913489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University