View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7997_low_8 (Length: 318)
Name: NF7997_low_8
Description: NF7997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7997_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 1083356 - 1083500
Alignment:
| Q |
1 |
aaactgaagacactactcaacaaagggacggttttgcttctggaggttagtatcttattttcttcctttaaattaaaaattcactttttatgaacaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1083356 |
aaactgaagacactactcaacaaagggacggttttgcttctggaggttagtatcttattttcttcctttaaattaaaaattcactttttatgaacaaaat |
1083455 |
T |
|
| Q |
101 |
caaaggaaccaagatgcaaatgcaaaagggttgtgttgtgtataa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1083456 |
caaaggaaccaagatgcaaatgcaaaagggttgtgttgtgtataa |
1083500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 250 - 317
Target Start/End: Complemental strand, 3499039 - 3498972
Alignment:
| Q |
250 |
agcatagggatgtacgtgtatgatttctctttttatatttgagatgaaggctgatgccatattattca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3499039 |
agcatagggatgtacgtgtatgatttctctttttatatttgagatgaaggctgatgccatattattca |
3498972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 2354145 - 2354191
Alignment:
| Q |
269 |
atgatttctctttttatatttgagatgaaggctgatgccatattatt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2354145 |
atgatttctctttttatatttgagatgaaggctgatgccatattatt |
2354191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 318
Target Start/End: Complemental strand, 2355119 - 2355070
Alignment:
| Q |
269 |
atgatttctctttttatatttgagatgaaggctgatgccatattattcaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
2355119 |
atgatttctctttttatatttgagatgaatgttgatgccatattattcaa |
2355070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University