View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7998_high_3 (Length: 414)
Name: NF7998_high_3
Description: NF7998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7998_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 46 - 270
Target Start/End: Complemental strand, 30563036 - 30562813
Alignment:
| Q |
46 |
actggggtttgagtgaaggattgaatcaatgaagtacttgaacagaacaatgaagagaaaaggagcacacaaacaaaacatggtgcttatttctaacttt |
145 |
Q |
| |
|
|||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30563036 |
actggggtttgaattaaggattcaatcaatgaagtacttgaacagaacaatgaagagaaaaggagcacacaaacaaaacatggtgcttatttctaacttt |
30562937 |
T |
 |
| Q |
146 |
agtatttaatgtgcgtgactggtaatagttgaatatgtaagaagaaaaattggtgatcagagaagttatctcagcaaaaagtttctccaatgactgacta |
245 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||||||||| |||| || | |
|
|
| T |
30562936 |
agtatttaatgtgagtggctggtaatagttgaatatgtaagaagaaaaattggtggtatgtgaagttatctcagc--aaagtttctccagtgacaaacca |
30562839 |
T |
 |
| Q |
246 |
tgatcagcag-aaaaagggcaagaat |
270 |
Q |
| |
|
||||||| || |||||||| |||||| |
|
|
| T |
30562838 |
tgatcagaagtaaaaagggtaagaat |
30562813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 376 - 413
Target Start/End: Original strand, 17208797 - 17208833
Alignment:
| Q |
376 |
atgtttataagtgagggacaatcctcatctcacaaacc |
413 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17208797 |
atgtttataagtgaggg-caatcctcatctcacaaacc |
17208833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University