View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7998_low_6 (Length: 233)
Name: NF7998_low_6
Description: NF7998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7998_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 52896122 - 52895939
Alignment:
| Q |
18 |
ccttccaccgtcaaacctcgctgccatgatctttgttcaattaaactacaggtaaatcaatatccccactttttcgtcggatctgattccacaacccact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
52896122 |
ccttccaccgtcaaacctcgctgccatgatctctgttcaattcaactacaggtaaatcaatatccccacttgttcgtcggatctgattccacatcccact |
52896023 |
T |
|
| Q |
118 |
tttctatcttcttttaatctctcttctaattttcacatctgccatcttcacttccagggaatatctcc-atctgtcgaacattc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
52896022 |
tttctatcttcttttaatctctcgtctaactttcacatctgccatcttcacttccagggaatatctccaatctgttgaacattc |
52895939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University