View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8002_high_1 (Length: 202)
Name: NF8002_high_1
Description: NF8002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8002_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 883399 - 883505
Alignment:
| Q |
8 |
tggagtagcagagatgatggcctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctacgttgtatgagatg |
107 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
883399 |
tggagaagcaaagatgatggcctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctatgttgtatgagatg |
883498 |
T |
 |
| Q |
108 |
gataagt |
114 |
Q |
| |
|
||||||| |
|
|
| T |
883499 |
gataagt |
883505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 138 - 183
Target Start/End: Original strand, 883523 - 883568
Alignment:
| Q |
138 |
gcgcaaccatataacctttaactctccaaagtcaggggtctcaact |
183 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
883523 |
gcgcaaccatataatctttaactctccaaagtcaggggtctcaact |
883568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University