View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8002_high_1 (Length: 202)

Name: NF8002_high_1
Description: NF8002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8002_high_1
NF8002_high_1
[»] chr5 (2 HSPs)
chr5 (8-114)||(883399-883505)
chr5 (138-183)||(883523-883568)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 883399 - 883505
Alignment:
8 tggagtagcagagatgatggcctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctacgttgtatgagatg 107  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
883399 tggagaagcaaagatgatggcctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctatgttgtatgagatg 883498  T
108 gataagt 114  Q
    |||||||    
883499 gataagt 883505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 138 - 183
Target Start/End: Original strand, 883523 - 883568
Alignment:
138 gcgcaaccatataacctttaactctccaaagtcaggggtctcaact 183  Q
    |||||||||||||| |||||||||||||||||||||||||||||||    
883523 gcgcaaccatataatctttaactctccaaagtcaggggtctcaact 883568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University