View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8003_low_13 (Length: 297)
Name: NF8003_low_13
Description: NF8003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8003_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 283
Target Start/End: Complemental strand, 29766934 - 29766665
Alignment:
| Q |
14 |
cgcccgcgcagttcggtttggattttggtttttgttttgccacccaaacctcagacttaattggggtgattggcatgtttaccatgttaccgtacacagt |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766934 |
cgcccgtgcagttcggtttggattttggtttttgttttgccacccaaacctcagacttaattggggtgattggcatgtttaccatgttaccgtacacagt |
29766835 |
T |
|
| Q |
114 |
agtttcagcaagtttgttttggttgtagttttcctgggtacagtttggtagctctgtaattaatcttacttgcccgaatatgacttgtcatatgtgttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766834 |
agtttcagcaagtttgttttggttgtagttttcctgggtacagtttggtagctctgtaattaatcttacttgcccgaatatgacttgtcatatgtgttgt |
29766735 |
T |
|
| Q |
214 |
agtttaattctcaatgaaactcttctatagttgcgggagacttgttattaggtccttaactgttcatact |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766734 |
agtttaattctcaatgaaactcttctatagttgcgggagacttgttattaggtccttaactgttcatact |
29766665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 283
Target Start/End: Complemental strand, 38854334 - 38854274
Alignment:
| Q |
223 |
ctcaatgaaactcttctatagttgcgggagacttgttattaggtccttaactgttcatact |
283 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||||| ||||||| || ||||| |||||| |
|
|
| T |
38854334 |
ctcaatgaagttgttctatggttgcgggagacttgttgttaggtctttgactgtgcatact |
38854274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University