View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8004_high_9 (Length: 277)
Name: NF8004_high_9
Description: NF8004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8004_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 2185201 - 2185448
Alignment:
| Q |
18 |
gatctttccggctaccacttcgatcttgctgggtacagcacttcattctttgtttcttatattatccattgtctcatcgtttaatcttgaaacagtaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2185201 |
gatctttccggctaccacttcgatcttgctgggtacaccacttcattctttgtttcttatattatccattgtctcatcgtttaatcttgaaacaggaaat |
2185300 |
T |
|
| Q |
118 |
tatttgaattgtagtaacatcaataatgataacgataatatgattatcaaattgtgatgcaatgactaatacttatctgattgtattggataggactgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2185301 |
tatttgaattgtagtaacatcaataatgataacgataatatgattatcaaattgtgatgcaatgactaatacttatctgattgtattggataggactgaa |
2185400 |
T |
|
| Q |
218 |
tatgaatccaattttattcaaggcatagttaaagaggtctcccacagg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2185401 |
tatgaatccaattttattcaaggcatagttaaagaggtctcccgcagg |
2185448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 21 - 105
Target Start/End: Original strand, 2184594 - 2184678
Alignment:
| Q |
21 |
ctttccggctaccacttcgatcttgctgggtacagcacttcattctttgtttcttatattatccattgtctcatcgtttaatctt |
105 |
Q |
| |
|
||||||||| |||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2184594 |
ctttccggccaccacttcaatcttgcggggtactccacttcattctttgtttcttatattatccattgtctcatcatttaatctt |
2184678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University