View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8004_low_10 (Length: 297)
Name: NF8004_low_10
Description: NF8004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8004_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 21 - 278
Target Start/End: Complemental strand, 26507427 - 26507170
Alignment:
| Q |
21 |
ggtgtttgtgtgtccgtacttcatagatcttcgacaacccttctttctcataaaaatgaaagatggtgattctaaagcacatcctagttttgtttattcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26507427 |
ggtgtttgtgtgtccgtacttcatagatcttcgacaacccttctttctcataaaaatgaaagatggtgattctaaagcacatcctagttttgtttattcc |
26507328 |
T |
 |
| Q |
121 |
aacctaaatattgtaaatcggcattctcatctcacattaatcgttacacctgaagggaaaagaaattaataatttcaatcaacaacaacttttttcacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26507327 |
aacctaaatattgtaaatcggcattctcatctcacattaatcgttacacctgaagggaaaagaaattaataatttcaatcaacaacaacttttttcacat |
26507228 |
T |
 |
| Q |
221 |
tatcaagtagtgtacatagtattcttgacggctttacccgaatatattttgtttttat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26507227 |
tatcaagtagtgtacatagtattcttgacggctttacccgaatatattttgtttttat |
26507170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University