View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8004_low_17 (Length: 218)
Name: NF8004_low_17
Description: NF8004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8004_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 34811760 - 34811865
Alignment:
| Q |
113 |
gaaggaaaggttgttggaaattaagtgtgagtaagaagtaacatatatcaaatgaaaatagacatgttgggcaaacagagaaatgaagttatccatatac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34811760 |
gaaggaaaggttgttggaaattaagtgtgagtaagaagtaacatatatcaaatgaaaatagacatgttgggcaaacagagaagtgaagttatccatatac |
34811859 |
T |
 |
| Q |
213 |
acttaa |
218 |
Q |
| |
|
|||||| |
|
|
| T |
34811860 |
acttaa |
34811865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University