View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8004_low_7 (Length: 368)
Name: NF8004_low_7
Description: NF8004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8004_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 200 - 347
Target Start/End: Original strand, 19024082 - 19024229
Alignment:
| Q |
200 |
agtgttatttttccaagaggaaaaaatatgtcagtttctttgatgacagttaacaaaaaatcctatagttattatttttaccatggaacagaacacaaac |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| || |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19024082 |
agtgttatttttccaagaggaaaaaatatgttagtttctttgatgatagttaacaagaagtcctatagttattattgttaccatggaacagaacacaaac |
19024181 |
T |
 |
| Q |
300 |
agagaatctaaagtgaaattcttaggagagatgattttgttaccactt |
347 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
19024182 |
agagaatctaaagtgaaattcttaggggaggtgattgtgttaccactt |
19024229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University