View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8005_high_9 (Length: 238)
Name: NF8005_high_9
Description: NF8005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8005_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 36541703 - 36541513
Alignment:
| Q |
1 |
aaggaaatatccacaac---ttgggtgatggtacgtccaactagtgatgtaaaagaaatgttgcatagaaggaaatccatgggttatagtcaaatttctt |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
36541703 |
aaggaaatatccacaacgacttgggtgatggtacgtccaactagagacgtaaaagaaatgttgcataggaggaaattcatgggttatagtcaattttctt |
36541604 |
T |
 |
| Q |
98 |
tttagtaactttgtatttgacgatgtcagttttctgttatgtatgtgttgaatattgtttatttcttgttagttgacattgtttgtttctt |
188 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541603 |
tttagtaactttgtctttgacgatgtcagttttctgttatgtatgtgttgaatattgtttatttcttgttagttgacattgtttgtttctt |
36541513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University