View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8006_low_5 (Length: 290)
Name: NF8006_low_5
Description: NF8006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8006_low_5 |
 | |
|
| [»] scaffold0045 (9 HSPs) |
| | |
|
Alignment Details
Target: scaffold0045 (Bit Score: 103; Significance: 3e-51; HSPs: 9)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 142 - 274
Target Start/End: Original strand, 35881 - 36010
Alignment:
| Q |
142 |
taatgcaggtgggagcttattaatccaaacgcagatataatttatctttcacatcctgctcctgttgatggggtcgaggtcaagttcagcaaattgtgag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35881 |
taatgcaggtgggagcttattaatccaaacgcagatatagtttatctttcacatcctgctccggttgatggggtcgaggtcaagttcagcagattgtgaa |
35980 |
T |
|
| Q |
242 |
gaaaaataaatcatgaaaattggattgtgttca |
274 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
35981 |
gaaa---aaatcatgaaaattggattgtgttca |
36010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 126 - 247
Target Start/End: Original strand, 43782 - 43903
Alignment:
| Q |
126 |
atattgatcaatttaataatgcaggtgggagcttattaatccaaacgcagatataatttatctttcacatcctgctcctgttgatggggtcgaggtcaag |
225 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
43782 |
atattgatcaatttaataatgctggtgggagctcattaatccaaacgcagatataatttatctttcgcatcctgctccagttgatggggttgaggtcaag |
43881 |
T |
|
| Q |
226 |
ttcagcaaattgtgaggaaaaa |
247 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
43882 |
ttcagcaaattgtgaagaaaaa |
43903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 142 - 247
Target Start/End: Original strand, 28041 - 28146
Alignment:
| Q |
142 |
taatgcaggtgggagcttattaatccaaacgcagatataatttatctttcacatcctgctcctgttgatggggtcgaggtcaagttcagcaaattgtgag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28041 |
taatgcaggtgggagcttattaatccaaatgcagatataatttatctttcacatcctgctcctgttgatggggttgaggtcaagttcagcaaattgtgaa |
28140 |
T |
|
| Q |
242 |
gaaaaa |
247 |
Q |
| |
|
|||||| |
|
|
| T |
28141 |
gaaaaa |
28146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 142 - 274
Target Start/End: Original strand, 52955 - 53083
Alignment:
| Q |
142 |
taatgcaggtgggagcttattaatccaaacgcagatataatttatctttcacatcctgctcctgttgatggggtcgaggtcaagttcagcaaattgtgag |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||| || |||||||| ||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52955 |
taatgcaggtaggagcttattaatccaaatgcagatataattcat-tttcacatgctgctccggttgatggggtcgaggtcaggttcagcaaattgtgag |
53053 |
T |
|
| Q |
242 |
gaaaaataaatcatgaaaattggattgtgttca |
274 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
53054 |
gaaa---aaatcatgaaaattggattgtgttca |
53083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #5
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 142 - 278
Target Start/End: Original strand, 21188 - 21325
Alignment:
| Q |
142 |
taatgcaggtgggagcttattaatccaaacgcagatat----aatttatctttcacatcctgctcctgttgatggggtcgaggtcaagttcagcaaattg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||| ||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21188 |
taatgcaggtgggagcttattaatccaaacgcaaatatatataatttatctttcacatgctgttccggttgatggggttgaggtcaggttcagcaaattg |
21287 |
T |
|
| Q |
238 |
tgaggaaaaataaatcatgaaaattggattgtgttcattca |
278 |
Q |
| |
|
||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
21288 |
tgaagaaa---aaatcatgaaaattggattgtattcattca |
21325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 43615 - 43708
Alignment:
| Q |
18 |
aaacatgcttgcaagaattcaactagcacttctgcttcatcatttgtccataggatacaagtaatgcttgctcctagtattttatagataacat |
111 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
43615 |
aaacatgcttgctagaattcaacttgcacttctgcttcatcatttgtcgataggatacaagtaatgcttgatcatagtatttgatagataacat |
43708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 52733 - 52822
Alignment:
| Q |
18 |
aaacatgcttgcaagaattcaactagcacttctgcttcatcatttgtccataggatacaagtaatgcttgctcctagtattttatagata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
52733 |
aaacatgcttgcaagaattcaactagcacttttgcttcatcatttatccatacgatacaagtaatgtttgatcctagtatttcatagata |
52822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 25 - 100
Target Start/End: Original strand, 27822 - 27897
Alignment:
| Q |
25 |
cttgcaagaattcaactagcacttctgcttcatcatttgtccataggatacaagtaatgcttgctcctagtatttt |
100 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
27822 |
cttgcaagaattcaacttgcacttctacttcatcatttgtccataggatacaagtaatgtttgatcatagtatttt |
27897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #9
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 35171 - 35236
Alignment:
| Q |
18 |
aaacatgcttgcaagaattcaactagcacttctgcttcatcatttgtccataggatacaagtaatg |
83 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35171 |
aaacatgcttgcgagaattcaacttgcacttctacttcatcatttgtccataggatacaagtaatg |
35236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University