View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8007_high_2 (Length: 240)
Name: NF8007_high_2
Description: NF8007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8007_high_2 |
 | |
|
| [»] chr5 (6 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 37196162 - 37196384
Alignment:
| Q |
18 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggtactttcttatttttgcttctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196162 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggtactttcttatttttgcttctata |
37196261 |
T |
|
| Q |
118 |
tatgttttggtcttttgatatcaattcattatgcttttgtacatactgtgagattgattttcttatagtatgtattaaattggttaaagggtaataggta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196262 |
tatgttttggtcttttgatatcaattcatgatgtttttgtacatactgtgagattgattttcttatagtatgtattaaattggttaaagggtaataggta |
37196361 |
T |
|
| Q |
218 |
tttgctattttacttttgatttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37196362 |
tttgctattttacttttgatttt |
37196384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 37440686 - 37440763
Alignment:
| Q |
18 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggta |
95 |
Q |
| |
|
||||||||||||| | ||| ||||| ||||||||||| || ||||| |||||| |||||| |||||| |||||||||| |
|
|
| T |
37440686 |
ctgagttgctgcagaggtacaacccaggtgtgaatttcagccaaggaagtggtctggtttttattccagggaaaggta |
37440763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 37221638 - 37221714
Alignment:
| Q |
18 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggt |
94 |
Q |
| |
|
||||||||||||| | ||| ||||||||||| ||||| || ||||| |||||| | |||| |||||| ||||||||| |
|
|
| T |
37221638 |
ctgagttgctgcagaggtacaaccctggtgtcaatttcagccaaggaagtggtcttgtttttattccagggaaaggt |
37221714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 37386841 - 37386765
Alignment:
| Q |
18 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggt |
94 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||| || |||| ||||| |||||| |||||| ||||||||| |
|
|
| T |
37386841 |
ctgagttgctacagaagtacaaccctggtgtgaatttcagcaaaggaagtgggctggtttttattccagggaaaggt |
37386765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 37227112 - 37227187
Alignment:
| Q |
19 |
tgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggt |
94 |
Q |
| |
|
|||||||||||| | ||| ||||||||||| ||||| || ||||| || ||| | ||||||||||| ||||||||| |
|
|
| T |
37227112 |
tgagttgctgcagaggtacaaccctggtgtcaatttcagccaaggaaggggtcttgtttatattccagggaaaggt |
37227187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 37201137 - 37201213
Alignment:
| Q |
18 |
ctgagttgctgcaaaagtataaccctggtgtgaattttagtcaagggagtggtttggtttatattcctgggaaaggt |
94 |
Q |
| |
|
||||||||||||| | ||| ||||||||||| ||||| || |||| |||||| | |||| |||||| ||||||||| |
|
|
| T |
37201137 |
ctgagttgctgcagaggtacaaccctggtgttaatttcagcaaaggaagtggtcttgtttttattccagggaaaggt |
37201213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University