View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_high_21 (Length: 355)
Name: NF8008_high_21
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 8 - 246
Target Start/End: Original strand, 28266015 - 28266252
Alignment:
| Q |
8 |
tatctatgtatgaagtgtacaaagctttaatttggcagagaaattcagccttcgtgagtctcctaattagttttaacatggggcatttaggatggtggac |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28266015 |
tatctatgtatgaagtgtgcaaagctttaatttggcagagaaattcaaccttcgtgagtctcctaattagttttaacatggatcatttaggatggtggac |
28266114 |
T |
|
| Q |
108 |
aaactcttttgcaccatcatggtgatgttaggaatga--atggaggtatatttttgggttagtcactatatgtttttaaaattcctcctacttgtattga |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28266115 |
aaactcttttggaccatcatggtgatgttaggaatgaatatggcggtatgtttttgggttagtcac--aatgtttttaaaattcctcctacttgtattga |
28266212 |
T |
|
| Q |
206 |
acaattttttattaacgacagtcagttaaatttgtttcgtt |
246 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
28266213 |
acaattttttattaatgaca-tcagttaaatttgtttcgtt |
28266252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University